← Back to JBEI Registry
p426_Cas9_gRNA-ARS308a
PLASMIDAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3.
- Institution
- JBEI
- ICE ID
- JPUB_007461
- Creator
- Amanda Reider Apel/ Leo d'Espaux
- TG Entity Type
- DNA-Sequence
- TeselaGen ID
- 75267394-d8bf-4519-a933-18b9328c2b87
- Tag
- Reider-Apel et al. 2016b
How to Access This Part
- Visit the TeselaGen Community portal.
- Sign in or create a free account.
- Open the corresponding entity library (e.g., DNA Sequences), click on "Import from External DB", select the "ICE Import.." option, and enter the corresponding name:
p426_Cas9_gRNA-ARS308a. - Select the entities, and click Import. A copy of the entities will be copied on your account.