← Back to JBEI Registry
JBEI-14488
STRAINARS1014a::pHSP26-TXS-ADH1t; 600bp promoter with lin52 linker to yeast CO truncated (minus first 59AA) TXS with 250bp terminator. Integrated using CRISPR/Cas9 pCut_1014a plasmid. Sequence of lin52 linker=CGCTCCCGTATTATCTCTGTAAGTAAAAAA
- Institution
- JBEI
- ICE ID
- JPUB_007559
- Creator
- Amanda Reider Apel/ Leo d'Espaux
- TG Entity Type
- Microbrial-Strain
- TeselaGen ID
- 73a315c8-c018-4dd2-b838-396a19a1ec7b
- Tag
- Reider-Apel et al. 2016b
How to Access This Part
- Visit the TeselaGen Community portal.
- Sign in or create a free account.
- Open the corresponding entity library (e.g., DNA Sequences), click on "Import from External DB", select the "ICE Import.." option, and enter the corresponding name:
JBEI-14488. - Select the entities, and click Import. A copy of the entities will be copied on your account.