JBEI
Browse the public JBEI registry of synthetic biological parts hosted by TeselaGen.
Access an Entry
To view a specific part, navigate to:
ice.teselagen.com/JBEI/entry/<ICE_ID>
Registry Entries(12,525)
← All institutions| ICE ID | Name | Type | Description |
|---|---|---|---|
| JPUB_024473 | pESC_URA_PW-13 | PLASMID | A pESC_URA plasmid that contains the synthetic gene construct tADH1-EcCPR-pGAL10/pGAL1-AtCYP90B1-tCYC1. |
| JPUB_024471 | pESC_URA_PW-12 | PLASMID | A pESC_URA plasmid that contains the synthetic gene construct tADH1-EcCPR-pGAL10/pGAL1-ArCYP71D443-tCYC1. |
| JPUB_024469 | pESC_URA_PW-11 | PLASMID | A pESC_URA plasmid that contains the synthetic gene construct tADH1-EcCPR-pGAL10/pGAL1-PpCYP90B27-tCYC1. |
| JPUB_024467 | pESC_URA_PW-10 | PLASMID | A pESC_URA plasmid that contains the synthetic gene construct tADH1-EcCPR-pGAL10/pGAL1-VcCYP90B27v1–mCherry-tCYC1. |
| JPUB_024465 | pESC_URA_PW-9 | PLASMID | A pESC_URA plasmid that contains the synthetic gene construct tADH1-EcCPR-pGAL10/pGAL1-VcCYP90B27v1-tCYC1. |
| JPUB_024463 | pESC_URA_PW-8 | PLASMID | A pESC_URA plasmid that contains the synthetic gene construct tADH1-StDHCR7-pGAL10/pGAL1-GgDHCR24-tCYC1. |
| JPUB_024461 | pESC_URA_PW-7 | PLASMID | A pESC_URA plasmid that contains the synthetic gene construct tADH1-DrDHCR7-pGAL10/pGAL1-GgDHCR24-tCYC1. |
| JPUB_024459 | pESC_URA_PW-6 | PLASMID | A pESC_URA plasmid that contains the synthetic gene construct tADH1-StDHCR7-pGAL10/pGAL1-DrDHCR24-tCYC1. |
| JPUB_024457 | pESC_URA_PW-5 | PLASMID | A pESC_URA plasmid that contains the synthetic gene construct tADH1-DrDHCR7-pGAL10/pGAL1-DrDHCR24-tCYC1. |
| JPUB_024455 | pESC_URA_PW-4 | PLASMID | A pESC_URA plasmid that contains the synthetic gene construct pGAL2-ERG1-tADH1-ERG9-pGAL10/pGAL1-ERG20-tCYC1-ERG7-pGAL7. |
| JPUB_024453 | p426_Cas9_gRNA-KanMX | PLASMID | All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting the KanMX marker (TTACTCACCACTGCGATCCC). |
| JPUB_023993 | RK2_WT_pCM2_GFP | PLASMID | RK2_WT_pCM2_GFP binary vector |
| JPUB_023995 | RK2_Truncation_1_90_pCM2_GFP | PLASMID | RK2_Truncation_1_90_pCM2_GFP binary vector |
| JPUB_023997 | RK2_S136T_pCM2_GFP | PLASMID | RK2_S136T_pCM2_GFP binary vector |
| JPUB_023999 | RK2_S20F_pCM2_GFP | PLASMID | RK2_S20F_pCM2_GFP binary vector |
| JPUB_024001 | RK2_R271L_pCM2_GFP | PLASMID | RK2_R271L_pCM2_GFP binary vector |
| JPUB_024003 | RK2_Q173R_pCM2_GFP | PLASMID | RK2_Q173R_pCM2_GFP binary vector |
| JPUB_024005 | RK2_Q60Stop_pCM2_GFP | PLASMID | RK2_Q60Stop_pCM2_GFP binary vector |
| JPUB_024007 | RK2_P63H_pCM2_GFP | PLASMID | RK2_P63H_pCM2_GFP binary vector |
| JPUB_024009 | RK2_N181H_pCM2_GFP | PLASMID | RK2_N181H_pCM2_GFP binary vector |
| JPUB_023991 | RK2_N174D_pCM2_GFP | PLASMID | RK2_N174D_pCM2_GFP binary vector |
| JPUB_024012 | RK2_I305K_pCM2_GFP | PLASMID | RK2_I305K_pCM2_GFP binary vector |
| JPUB_024014 | RK2_I288L_pCM2_GFP | PLASMID | RK2_I288L_pCM2_GFP binary vector |
| JPUB_024016 | RK2_E170K_pCM2_GFP | PLASMID | RK2_E170K_pCM2_GFP binary vector |
| JPUB_024018 | RK2_E22Stop_pCM2_GFP | PLASMID | RK2_E22Stop_pCM2_GFP binary vector |
| JPUB_024020 | RK2_A171V_pCM2_GFP | PLASMID | RK2_A171V_pCM2_GFP binary vector |
| JPUB_024022 | pCL2_eGFP_BBR1_V128I.gb | PLASMID | BBR1 V128I. pCL2_eGFP binary vector |
| JPUB_024024 | pCL2_eGFP_BBR1_V99L.gb | PLASMID | BBR1 V99L. pCL2_eGFP binary vector |
| JPUB_024026 | pCL2_eGFP_BBR1_V91M.gb | PLASMID | BBR1 V91M. pCL2_eGFP binary vector |
| JPUB_024028 | pCL2_eGFP_BBR1_T148A.gb | PLASMID | BBR1 T148A.. pCL2_eGFP binary vector |
| JPUB_024030 | pCL2_eGFP_BBR1_T74M.gb | PLASMID | BBR1 T74M. pCL2_eGFP binary vector |
| JPUB_024032 | pCL2_eGFP_BBR1_S100L.gb | PLASMID | BBR1 S100L. pCL2_eGFP binary vector |
| JPUB_024034 | pCL2_eGFP_BBR1_P96L.gb | PLASMID | BBR1 P96L. pCL2_eGFP binary vector |
| JPUB_024036 | pCL2_eGFP_BBR1_L138F.gb | PLASMID | BBR1 L138F. pCL2_eGFP binary vector |
| JPUB_024038 | pCL2_eGFP_BBR1_K92N.gb | PLASMID | BBR1 K92N. pCL2_eGFP binary vector |
| JPUB_024040 | pCL2_eGFP_BBR1_K66Q.gb | PLASMID | BBR1 K66Q.. pCL2_eGFP binary vector |
| JPUB_024042 | pCL2_eGFP_BBR1_H130N.gb | PLASMID | BBR1 H130N. pCL2_eGFP binary vector |
| JPUB_024044 | pCL2_eGFP_BBR1_G141D.gb | PLASMID | BBR1 G141D. pCL2_eGFP binary vector |
| JPUB_024046 | pCL2_eGFP_BBR1_E182V.gb | PLASMID | BBR1 E182V. pCL2_eGFP binary vector |
| JPUB_024048 | pCL2_eGFP_BBR1_D134N.gb | PLASMID | BBR1 D134N. pCL2_eGFP binary vector |
| JPUB_024050 | pCL2_eGFP_BBR1_D132V.gb | PLASMID | BBR1 D132V. pCL2_eGFP binary vector |
| JPUB_024052 | pCL2_eGFP_BBR1_D129E.gbk | PLASMID | BBR1 D129E. pCL2_eGFP binary vector |
| JPUB_024054 | pVS1_PC6_GFP_WT.gb | PLASMID | pVS1 WT. pCL2_eGFP binary vector |
| JPUB_024056 | pVS1_PC6_GFP_V218G.gb | PLASMID | pVS1 V218G. pCL2_eGFP binary vector |
| JPUB_024058 | pVS1_PC6_GFP_T199N.gb | PLASMID | pVS1 T199N. pCL2_eGFP binary vector |
| JPUB_024060 | pVS1_PC6_GFP_S126Y.gb | PLASMID | pVS1 S126Y. pCL2_eGFP binary vector |
| JPUB_024062 | pVS1_PC6_GFP_R227S.gb | PLASMID | pVS1 R227S. pCL2_eGFP binary vector |
| JPUB_024064 | pVS1_PC6_GFP_R106H.gb | PLASMID | pVS1 R106H. pCL2_eGFP binary vector |
| JPUB_024066 | pVS1_PC6_GFP_K310Q.gb | PLASMID | pVS1 K310Q. pCL2_eGFP binary vector |
| JPUB_024068 | pVS1_PC6_GFP_K229N.gb | PLASMID | pVS1 K229N. pCL2_eGFP binary vector |