JBEI

Browse the public JBEI registry of synthetic biological parts hosted by TeselaGen.

Access an Entry

To view a specific part, navigate to:

ice.teselagen.com/JBEI/entry/<ICE_ID>

Registry Entries(12,525)

ICE ID	Name	Type	Description
JPUB_009881	JBEI-14592	STRAIN	Plasmid pAM2398-ispD-fldA, harboring BtispG gene (Bacillus thuriengensis) under control of the GAL1 promoter, and EcispD (E. coli) under control of the BIO2 promoter and fldA from E. coli. See upcoming paper "Engineering a functional 1-deoxy-D-xylulose 5-phosphate (DXP) pathway in Saccharomyces cerevisiae" for full description.
JPUB_009879	JBEI-14577	STRAIN	Plasmid pAM2398-ispD-sufA, harboring BtispG gene (Bacillus thuriengensis) under control of the GAL1 promoter, and EcispD (E. coli) under control of the BIO2 promoter and sufA from B. subtilis. See upcoming paper "Engineering a functional 1-deoxy-D-xylulose 5-phosphate (DXP) pathway in Saccharomyces cerevisiae" for full description.
JPUB_009877	JBEI-14576	STRAIN	Plasmid pAM2397-ispD-SOD1, harboring BtispG gene (Bacillus thuriengensis) under control of the GAL1 promoter, and EcispD (E. coli) under control of the BIO2 promoter and SOD1 from S. cerevisiae. See upcoming paper "Engineering a functional 1-deoxy-D-xylulose 5-phosphate (DXP) pathway in Saccharomyces cerevisiae" for full description.
JPUB_009875	JBEI-14578	STRAIN	Plasmid pAM2397, harboring BtispG gene (Bacillus thuriengensis) under control of the GAL1 promoter, and EcispD (E. coli) under control of the BIO2 promoter. See upcoming paper "Engineering a functional 1-deoxy-D-xylulose 5-phosphate (DXP) pathway in Saccharomyces cerevisiae" for full description.
JPUB_009873	JBEI-14579	STRAIN	Plasmid pAM2398, harboring BtispG gene (Bacillus thuringiensis) under control of the GAL1 promoter. See upcoming paper "Engineering a functional 1-deoxy-D-xylulose 5-phosphate (DXP) pathway in Saccharomyces cerevisiae" for full description.
JPUB_009871	JBEI-14580	STRAIN	Plasmid pAM2397, harboring BsispG gene (Bacillus subtilis) under control of the GAL1 promoter. See upcoming paper "Engineering a functional 1-deoxy-D-xylulose 5-phosphate (DXP) pathway in Saccharomyces cerevisiae" for full description.
JPUB_009869	JBEI-14598	STRAIN	CEN.PK2 erg13::LEU2, PRM10 (L156Q) containing DXP pathway genes. See upcoming paper "Engineering a functional 1-deoxy-D-xylulose 5-phosphate (DXP) pathway in Saccharomyces cerevisiae" for full description.
JPUB_009868	JBEI-14597	STRAIN	CEN.PK2 erg13::LEU2, PRM10 (L156Q) containing DXP pathway genes. See upcoming paper "Engineering a functional 1-deoxy-D-xylulose 5-phosphate (DXP) pathway in Saccharomyces cerevisiae" for full description.
JPUB_009866	JBEI-14603	STRAIN	CEN.PK2 erg13::LEU2, PRM10 (L156Q) containing DXP pathway genes. See upcoming paper "Engineering a functional 1-deoxy-D-xylulose 5-phosphate (DXP) pathway in Saccharomyces cerevisiae" for full description.
JPUB_009864	JBEI-14602	STRAIN	CEN.PK2 erg13::LEU2, PRM10 (L156Q) containing DXP pathway genes. See upcoming paper "Engineering a functional 1-deoxy-D-xylulose 5-phosphate (DXP) pathway in Saccharomyces cerevisiae" for full description.
JPUB_009863	JBEI-14601	STRAIN	CEN.PK2 erg13::LEU2, PRM10 (L156Q) containing DXP pathway genes. See upcoming paper "Engineering a functional 1-deoxy-D-xylulose 5-phosphate (DXP) pathway in Saccharomyces cerevisiae" for full description.
JPUB_009862	JBEI-14600	STRAIN	CEN.PK2 erg13::LEU2, PRM10 (L156Q) containing DXP pathway genes. See upcoming paper "Engineering a functional 1-deoxy-D-xylulose 5-phosphate (DXP) pathway in Saccharomyces cerevisiae" for full description.
JPUB_009861	JBEI-14599	STRAIN	CEN.PK2 erg13::LEU2, PRM10 (L156Q) containing DXP pathway genes. See upcoming paper "Engineering a functional 1-deoxy-D-xylulose 5-phosphate (DXP) pathway in Saccharomyces cerevisiae" for full description.
JPUB_018674	JBEI-14582	STRAIN	BsaI, {Kan::LeftBorder::35S:HygR::L_tOcs}
JPUB_008729	JBEI-14575	STRAIN	BW25113- pBbE5c-YFP
JPUB_008727	JBEI-14585	STRAIN	JW3887 pBb5c-YFP
JPUB_007579	JBEI-14570	STRAIN	See Plasmid
JPUB_007577	JBEI-14569	STRAIN	See plasmid
JPUB_008966	JBEI-14548	STRAIN	DH1 with pA5c-MevTo-T21-Mkco (JBx_039538) and pTrc99a-PMD mutants for isopentenol production via IPP-bypass MVA pathway
JPUB_008964	JBEI-14526	STRAIN	DH1 with pA5c-MevTo-T21-Mkco (JBx_039538) and pTrc99a-PMD mutants for isopentenol production via IPP-bypass MVA pathway
JPUB_008962	JBEI-14528	STRAIN	DH1 with pA5c-MevTo-T21-Mkco (JBx_039538) and pTrc99a-PMD mutants for isopentenol production via IPP-bypass MVA pathway
JPUB_008960	JBEI-14530	STRAIN	DH1 with pA5c-MevTo-T21-Mkco (JBx_039538) and the specified pTrc99a-PMD mutants for isopentenol production via IPP-bypass MVA pathway
JPUB_008958	JBEI-14532	STRAIN	DH1 with pA5c-MevTo-T21-Mkco (JBx_039538) and the specified pTrc99a-PMD mutants for isopentenol production via IPP-bypass MVA pathway
JPUB_008957	JBEI-14534	STRAIN	DH1 with pA5c-MevTo-T21-Mkco (JBx_039538) and the specified pTrc99a-PMD mutants for isopentenol production via IPP-bypass MVA pathway
JPUB_008955	JBEI-14560	STRAIN	DH1 with pA5c-MevTo-T21-Mkco (JBx_039538) and the specified pTrc99a-PMD mutants for isopentenol production via IPP-bypass MVA pathway
JPUB_008953	JBEI-14574	STRAIN	DH1 with pA5c-MevTo-T21-Mkco (JBx_039538) and the specified pTrc99a-PMD mutants for isopentenol production via IPP-bypass MVA pathway
JPUB_008951	JBEI-14559	STRAIN	DH1 with pA5c-MevTo-T21-Mkco (JBx_039538) and the specified pTrc99a-PMD mutants for isopentenol production via IPP-bypass MVA pathway
JPUB_008949	JBEI-14558	STRAIN	DH1 with pA5c-MevTo-T21-Mkco and pTrc99a-PMD mutants for isopentenol production via IPP-bypass MVA pathway
JPUB_008947	JBEI-14527	STRAIN	DH1 with pA5c-MevTo-T21-Mkco (JBx_039538) and the specified pTrc99a-PMD mutants for isopentenol production via IPP-bypass MVA pathway
JPUB_008945	JBEI-14518	STRAIN	DH1 with pA5c-MevTo-T21-Mkco (JBx_039538) and the specified pTrc99a-PMD mutants for isopentenol production via IPP-bypass MVA pathway
JPUB_008943	JBEI-14517	STRAIN	DH1 with pA5c-MevTo-T21-Mkco (JBx_039538) and the specified pTrc99a-PMD mutants for isopentenol production via IPP-bypass MVA pathway
JPUB_008941	JBEI-14522	STRAIN	DH1 with pA5c-MevTo-T21-Mkco (JBx_039538) and the specified pTrc99a-PMD mutants for isopentenol production via IPP-bypass MVA pathway
JPUB_008939	JBEI-14520	STRAIN	DH1 with pA5c-MevTo-T21-Mkco (JBx_039538) and the specified pTrc99a-PMD mutants for isopentenol production via IPP-bypass MVA pathway
JPUB_008937	JBEI-14537	STRAIN	DH1 with pA5c-MevTo-T21-Mkco (JBx_039538) and the specified pTrc99a-PMD mutants for isopentenol production via IPP-bypass MVA pathway
JPUB_008935	JBEI-14542	STRAIN	DH1 with pA5c-MevTo-T21-Mkco and pTrc99a-PMD mutants for isopentenol production via IPP-bypass MVA pathway
JPUB_008933	JBEI-14540	STRAIN	DH1 with pA5c-MevTo-T21-Mkco (JBx_039538) and the specified pTrc99a-PMD mutants for isopentenol production via IPP-bypass MVA pathway
JPUB_008931	JBEI-14567	STRAIN	DH1 with pA5c-MevTo-T21-Mkco (JBx_039538) and the specified pTrc99a-PMD mutants for isopentenol production via IPP-bypass MVA pathway
JPUB_007570	JBEI-14514	STRAIN	GFP-MBP
JPUB_007569	JBEI-14513	STRAIN	GFP-NYV1
JPUB_007568	JBEI-14512	STRAIN	GFP-PEX8
JPUB_007567	JBEI-14511	STRAIN	GFP-CYB5
JPUB_007566	JBEI-14510	STRAIN	GFP-CNE1
JPUB_007565	JBEI-14509	STRAIN	GFP-SNC1
JPUB_007564	JBEI-14508	STRAIN	COX4-GFP
JPUB_007563	JBEI-14480	STRAIN	ARS1014a::pTDH3-TXS-ADH1t ; 600bp promoter to yeast CO truncated (minus first 59AA) TXS to 250bp terminator. Integrated using CRISPR/Cas9 pCut_1014a plasmid.
JPUB_007562	JBEI-14477	STRAIN	ARS1014a::pTDH3-TXS-CYB5tag-ADH1t; 600bp promoter to yeast CO truncated (minus first 59AA) TXS with 6xgly linker to 250bp terminator. Integrated using CRISPR/Cas9 pCut_1014a plasmid.
JPUB_007561	JBEI-14466	STRAIN	ARS1014a::pTDH3-MBP-TXS-ADH1t; 600bp promoter with 6xgly linker to yeast CO truncated (minus first 59AA) TXS with 250bp terminator. Integrated using CRISPR/Cas9 pCut_1014a plasmid.
JPUB_007560	JBEI-14472	STRAIN	ARS1014a::pTDH3-UbiS-TXS-ADH1t; 600bp promoter with 6xgly linker to yeast CO truncated (minus first 59AA) TXS with 250bp terminator. Integrated using CRISPR/Cas9 pCut_1014a plasmid.
JPUB_007559	JBEI-14488	STRAIN	ARS1014a::pHSP26-TXS-ADH1t; 600bp promoter with lin52 linker to yeast CO truncated (minus first 59AA) TXS with 250bp terminator. Integrated using CRISPR/Cas9 pCut_1014a plasmid. Sequence of lin52 linker=CGCTCCCGTATTATCTCTGTAAGTAAAAAA
JPUB_007558	JBEI-14482	STRAIN	ARS1014a::pHHF1-TXS-ADH1t; 600bp promoter with lin52 linker to yeast CO truncated (minus first 59AA) TXS with 250bp terminator. Integrated using CRISPR/Cas9 pCut_1014a plasmid. Sequence of lin52 linker=CGCTCCCGTATTATCTCTGTAAGTAAAAAA

12,525 entries · Page 216 of 251

← Prev 1…213 214 215 216 217 218 219…251 Next →