JBEI
Browse the public JBEI registry of synthetic biological parts hosted by TeselaGen.
Access an Entry
To view a specific part, navigate to:
ice.teselagen.com/JBEI/entry/<ICE_ID>
Registry Entries(12,525)
← All institutions| ICE ID | Name | Type | Description |
|---|---|---|---|
| JPUB_007571 | pcut-R_607c | PLASMID | p426_Cas9_gRNA-ARS607c without ribozyme. All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6. |
| JPUB_009677 | 2-GPD1-BIS-Tnos | PLASMID | Bisabolene synthase (BIS) gene codon-optimized for expression in Rhodosporidium toruloides |
| JPUB_009668 | 1-GPD1-ADS-Tnos | PLASMID | Amorphadiene synthase (ADS) gene codon-optimized for expression in Rhodosporidium toruloides |
| JPUB_011109 | pRK793 (MBP-6xHis-TEV protease) | PLASMID | All information is included here:. https://www.addgene.org/8827/. or . http://qb3.berkeley.edu/qb3/macrolab/b6_tevprotease.cfm for details on the protein |
| JPUB_008780 | pBbA5c-MTSA-T1-MBI(fixed)-Ptrc-CSstr | PLASMID | pBbA5c-MTSA-T1-MBI(fixed) with bacterial cineole synthase |
| JPUB_007828 | pET-RC-CelC-TEVHis | PLASMID | pET39b(+) derivative with celC from 'Candidatus Reconcilibacillus cellulovorans' cloned for expression in E.coli. C-terminal TEV site and 6xHis tag.. IPTG induced overexpression in E.coli. |
| JPUB_008905 | pGREG523-pSPT23-mycSPT23 | PLASMID | Yeast expression plasmid (CEN/ARS, HIS3) expression a C-terminal 13 x myc tagged SPT23. Expression is from the native SPT23 promoter. |
| JPUB_008908 | pCM188-SPT23p90 | PLASMID | Yeast expression plasmid (CEN/ARS, URA3) driving expression of truncated SPT23 (p90 fragment). Expression is via a doxycycline repressible tetO-CYC1 promoter. |
| JPUB_011379 | pDVA00936 | PLASMID | pAVint_pErmE, pAVint_GapDH, pAC1_pErmE, pAC1_GapDH, |
| JPUB_008922 | pA5c-MevT(O)-T21-MKco-EcIDI-MtIPK | PLASMID | A plasmid bearing the three upper genes of MVA pathway from Saccharomyces cerevisiae, codon-optimized mevalonate kinase from Saccharomyces cerevisiae, isopentenyl pyrophosphate delta isomerase from Escheria coli and isopentenol phosphate kinase from Methanocaldococcus jannaschii. |
| JPUB_007826 | pET-RC-CelBopt-TEVHis | PLASMID | pET39b(+) derivative with celB from 'Candidatus Reconcilibacillus cellulovorans' codon optimized for expression in E.coli. C-terminal TEV site and 6xHis tag.. IPTG induced overexpression in E.coli. |
| JPUB_008467 | pBbS2a-CB-CA-RN-EC | PLASMID | pBbS2a with CB from C. beijerinckii, CA from E. coli, RNaas from Rattus norvegicus, and ECaat from E. coli |
| JPUB_008465 | pBbS2a-CB-CA | PLASMID | pBbS2a with ADH from C. beijerinckii and CA from E. coli |
| JPUB_008456 | pBbS5a-CB | PLASMID | ADH from Clostridium beijerinckii |
| JPUB_008454 | pBbS5a-PF | PLASMID | ADH from Pseudomonas fluorescens in the pBbS5a vector |
| JPUB_007779 | pYL156 NbPAGR | PLASMID | Silencing construct used to silence NbPAGR A and B |
| JPUB_007778 | pGWB44 PAGR-CFP | PLASMID | PAGR (At3g26370) - CFP |
| JPUB_007776 | pENTR PAGR_NS | PLASMID | PAGR / At3g26370 without a stop codon in pENTR |
| JPUB_008439 | pBbE8c-XAacx | PLASMID | codon-optimized ACX from Xanthobacter in pBbE8c |
| JPUB_008435 | pBbE5c-XAacx | PLASMID | codon-optimized ACX from Xanthobacter in pBbE5c vector |
| JPUB_008433 | pBbE1c-XAacx | PLASMID | codon-optimized ACX from Xanthobacter in pBbE1c vector |
| JPUB_010117 | pPIACE_Gent_AtoB-mvaS-mvaA | PLASMID | PIR strain for plasmid replication. |
| JPUB_007546 | pcut_LEU_1014a | PLASMID | p425_Cas9_gRNA-ARS1014a . All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10. |
| JPUB_007545 | pcut-R_1206a | PLASMID | p426_Cas9_gRNA-ARS1206a without ribozyme. All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1206a sequence CGAACATTTTTCCATGCGCT in yeast chromosome 12. |
| JPUB_007544 | pcut-R_607b | PLASMID | p426_Cas9_gRNA-ARS607b without ribozyme. All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607b sequence CCAGCGTAAGGTAAATATTA in yeast chromosome 6. |
| JPUB_007543 | pcut-R_RDS1a | PLASMID | p426_Cas9_gRNA-RDS1a without the ribozyme. All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3. |
| JPUB_010054 | PLASMID | pMCK-g48 | |
| JPUB_010052 | PLASMID | pMCK-g47 | |
| JPUB_010050 | PLASMID | pMCC-g44 | |
| JPUB_010048 | pMCK-gCrM-M' | PLASMID | pMCK-g48 |
| JPUB_010047 | pMCK-gCrT-T' | PLASMID | pMCK-g47 |
| JPUB_010046 | pMCC-gCrB-B' | PLASMID | pMCC-g44 |
| JPUB_008390 | pDNR1-2 PvHCT2a E. coli codon-optimized | PLASMID | pDNR1-2 PvHCT2a E. coli codon-optimized |
| JPUB_008388 | pTKan pCesa4::schl-ubiC-pC4H::schl-pobA | PLASMID | pTKan pCesa4::schl-ubiC-pC4H::schl-pobA |
| JPUB_008386 | pTKan pC4H::schl-pobA | PLASMID | pTKan pC4H::schl-pobA |
| JPUB_008384 | pDNR3-2 pobA | PLASMID | pDNR3-2 pobA |
| JPUB_008382 | pTKan pCesa4::schl-ubiC | PLASMID | pTKan pCesa4::schl-ubiC |
| JPUB_008380 | pDNR1-2 schl-ubiC | PLASMID | pDNR1-2 schl-ubiC |
| JPUB_008378 | pDNR1-4 schl-ubiC | PLASMID | pDNR1-4 schl-ubiC |
| JPUB_008376 | pSKB3 PvHCT2a | PLASMID | pSKB3 PvHCT2a |
| JPUB_008374 | pDEST17 PvHCT2a | PLASMID | pDEST17 PvHCT2a |
| JPUB_008372 | pDR 4CL5-PpHCT1 | PLASMID | pDR 4CL5-PpHCT1 |
| JPUB_008370 | pDR 4CL5-SmHCT1a | PLASMID | pDR 4CL5-SmHCT1a |
| JPUB_008368 | pDR 4CL5-PrHCT | PLASMID | pDR 4CL5-PrHCT |
| JPUB_008366 | pDR 4CL5-PvHCT2a | PLASMID | pDR 4CL5-PvHCT2a |
| JPUB_008364 | pDR 4CL5-PtHCT6 | PLASMID | pDR 4CL5-PtHCT6 |
| JPUB_008362 | pDR 4CL5-AtHCT | PLASMID | pDR 4CL5-AtHCT |
| JPUB_008360 | pDNR1-2 PpHCT1 | PLASMID | pDNR1-2 PpHCT1 |
| JPUB_008358 | pDNR1-2 SmHCT1a | PLASMID | pDNR1-2 SmHCT1a |
| JPUB_008356 | pDNR1-2 PrHCT | PLASMID | pDNR1-2 PrHCT |