TeselaGenICE

JBEI

Browse the public JBEI registry of synthetic biological parts hosted by TeselaGen.

Access an Entry

To view a specific part, navigate to:

ice.teselagen.com/JBEI/entry/<ICE_ID>

Registry Entries(12,525)

← All institutions
ICE IDNameTypeDescription
JPUB_007057pBullet-pm-c-AT1G80640.1PLASMIDpBullet-pm-c-AT1G80640.1
JPUB_007056pBullet-pm-c-AT1G73650.3PLASMIDpBullet-pm-c-AT1G73650.3
JPUB_007055pBullet-pm-c-AT1G52100.1PLASMIDpBullet-pm-c-AT1G52100.1
JPUB_007054pBullet-pm-c-AT1G51940.1PLASMIDpBullet-pm-c-AT1G51940.1
JPUB_007053pBullet-pm-c-AT1G12080.2PLASMIDpBullet-pm-c-AT1G12080.2
JPUB_008776ptrc-GPPS-CS-IspAPLASMIDBacterial cineole synthase and E coli's ispA
JPUB_008762pBbA5c-MTSA-T1-MBI-T1002-ptrc-GPPS-LinSPLASMIDLinalool synthase
JPUB_008764pBbA5c-MTSA-T1-MBI-T1002-ptrc-GPPS-PSPLASMIDPinene synthase-GPPS fusion with mevalonate genes
JPUB_008760pBbA5c-MTSA-T1-MBI-T1002-ptrc-GPPS-CShyp3PLASMIDCineole synthase Hyp3 in one plasmid with all mevalonate pathway genes
JPUB_007481p426_Cas9_gRNA-YPRCd15cPLASMIDAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.
JPUB_007480p426_Cas9_gRNA-ARS1622bPLASMIDAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1622b sequence GTCACGTTCCTGAGGTTACT in yeast chromosome 16.
JPUB_007479p426_Cas9_gRNA-HIS3bPLASMIDAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.
JPUB_007478p426_Cas9_gRNA-YOLCd1bPLASMIDAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.
JPUB_007477p426_Cas9_gRNA-ARS1414aPLASMIDAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14.
JPUB_007476p426_Cas9_gRNA-ARS1309aPLASMIDAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13.
JPUB_007475p426_Cas9_gRNA-ARS1206aPLASMIDAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1206a sequence CGAACATTTTTCCATGCGCT in yeast chromosome 12.
JPUB_007474p426_Cas9_gRNA-ARS1114aPLASMIDAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1114a sequence CTTGTGAAACAAATAATTGG in yeast chromosome 11.
JPUB_007473p426_Cas9_gRNA-ARS1014aPLASMIDAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.
JPUB_007472p426_Cas9_gRNA-ARS1021bPLASMIDAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1021b sequence CCTCTGTGTGGTGGTAATTG in yeast chromosome 10.
JPUB_007471p426_Cas9_gRNA-ARS911bPLASMIDAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.
JPUB_007470p426_Cas9_gRNA-ARS805aPLASMIDAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.
JPUB_007469p426_Cas9_gRNA-ARS720aPLASMIDAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS720a sequence CAACAATTGTTACAATAGTA in yeast chromosome 7.
JPUB_007468p426_Cas9_gRNA-CAN1yPLASMIDAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.
JPUB_007467p426_Cas9_gRNA-SAP155cPLASMIDAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155c sequence ATGAAAGACAACTATAGGGC. in yeast chromosome 6.
JPUB_007466p426_Cas9_gRNA-SAP155bPLASMIDAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155b sequence GGTTTTCATACTGGGGCCGC in yeast chromosome 6.
JPUB_007465p426_Cas9_gRNA-ARS607cPLASMIDAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.
JPUB_007464p426_Cas9_gRNA-ARS511bPLASMIDAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS511b sequence CAGTGTATGCCAGTCAGCCA in yeast chromosome 5.
JPUB_007463p426_Cas9_gRNA-ARS416dPLASMIDAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.
JPUB_007462p426_Cas9_gRNA-RDS1aPLASMIDAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.
JPUB_007461p426_Cas9_gRNA-ARS308aPLASMIDAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3.
JPUB_007460p426_Cas9_gRNA-ARS208aPLASMIDAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.
JPUB_007459p426_Cas9_gRNA-ARS106aPLASMIDAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.
JPUB_008462pBbS5a-CB-CA-RNaas-ECaatPLASMIDplacing the E. coli thiolase behind the acetoacetate CoA ligase from RN
JPUB_006809C-StrepII-3607PLASMIDfor expression of C-StrepII-3607
JPUB_006807N-StrepII-3607PLASMIDfor expression of N-StrepII-3607
JPUB_006805N-StrepII-EcAcpPPLASMIDcarries N-StrepII-EcAcpP
JPUB_006803N-8xHis-StrepII-MBP-3607PLASMIDfor expression of N-8xHis-StrepII-MBP-3607
JPUB_006850N-His-3347PLASMIDfor expression of N-His-3347
JPUB_006848N-His-3338PLASMIDfor expression of N-His-3338
JPUB_006846MBP-3347PLASMIDfor expression of MBP-3347
JPUB_006844MBP-3338PLASMIDfor expression of MBP-3338
JPUB_006842tagless 3608PLASMIDfor expression of tagless 3608
JPUB_006840tagless 3343PLASMIDfor expression of tagless 3343
JPUB_006838tagless 3342PLASMIDfor expression of tagless 3342
JPUB_006836tagless 2803PLASMIDfor expression of tagless 2803
JPUB_006834C-His-3608PLASMIDfor expression of C-His-3608
JPUB_006832C-His-3343PLASMIDfor expression of C-His-3343
JPUB_006830C-His-3342PLASMIDfor expression of C-His-3342
JPUB_006828C-His-2803PLASMIDfor expression of C-His-2803
JPUB_006826N-His-3608PLASMIDfor expression of N-His-3608

12,525 entries · Page 76 of 251